View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_232 (Length: 244)
Name: NF10092A_low_232
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_232 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 37492341 - 37492128
Alignment:
| Q |
12 |
atgaaatggaatggattggatcagaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaagtaa |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492341 |
atgaaatggaatggattggatcggaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaagtaa |
37492242 |
T |
 |
| Q |
112 |
aacaaccaaagaaatcgaagcatcattacaaaaataagagtagcatcattctaatttgaaattaaatgtaaacagaatgatcttaaccactatgcagtat |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37492241 |
aacaaccaaagaaatcaaagcatcattacaaaaataagagtagcatcattctgatttgaaattaaatgtaaacagaatgattttaaccactatgcagtat |
37492142 |
T |
 |
| Q |
212 |
gcacatacaccatg |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37492141 |
gcacatacaccatg |
37492128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University