View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_234 (Length: 243)
Name: NF10092A_low_234
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_234 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 30455876 - 30456074
Alignment:
| Q |
23 |
atcaatcttgctaagagaaatcttttgggggtggaggaatctaaaaggtgtgtgttttgtgagggtggtgatgagtcgatgactcatctctttcttcatt |
122 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30455876 |
atcaatcttgctaagaaaaatcttttgggggtggaggaatctaaaaggtgtgtgttttgtgagggtggtgatgaatcgatgactcatctctttcttcatt |
30455975 |
T |
 |
| Q |
123 |
gtgagtgggtttcgaaagtttggtcggaggtgataaggtggttggattttacttttatcacgccgccgaatttatttgtccatgctttatgttggacta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30455976 |
gtgagtgggtttcgaaagtttggtcggaggtgataaggtggttggattttacttttatcatgccgtcgaatttatttgtccatgctttatgttggacta |
30456074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 199
Target Start/End: Original strand, 5745743 - 5745916
Alignment:
| Q |
26 |
aatcttgctaagagaaatcttttgggggtggaggaatctaaaaggtgtgtgttttgtgagggtggtgatgagtcgatgactcatctctttcttcattgtg |
125 |
Q |
| |
|
|||||||| ||||||| ||| ||| ||| ||| |||||||||||||||||||||||||| | || || || |||| | |||||| |||||||||||| |
|
|
| T |
5745743 |
aatcttgcgaagagaagtctattgcgggaggatgaatctaaaaggtgtgtgttttgtgatgaaggggaagaatcgacaattcatctttttcttcattgta |
5745842 |
T |
 |
| Q |
126 |
agtgggtttcgaaagtttggtcggaggtgataaggtggttggattttacttttatcacgccgccgaatttattt |
199 |
Q |
| |
|
|||||||||||||||||| ||||| || ||| |||| |||||| | ||||||| ||||| ||||||||| |
|
|
| T |
5745843 |
gttgggtttcgaaagtttggagagaggttatgcggttgttgaattttaatcttatcaccccgcctaatttattt |
5745916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 199
Target Start/End: Original strand, 5782702 - 5782875
Alignment:
| Q |
26 |
aatcttgctaagagaaatcttttgggggtggaggaatctaaaaggtgtgtgttttgtgagggtggtgatgagtcgatgactcatctctttcttcattgtg |
125 |
Q |
| |
|
|||||||| ||||||| ||| ||| ||| ||| |||||||||||||||||||||||||| | || || || |||| | |||||| |||||||||||| |
|
|
| T |
5782702 |
aatcttgcgaagagaagtctattgcgggaggatgaatctaaaaggtgtgtgttttgtgatgaaggggaagaatcgacaattcatctttttcttcattgta |
5782801 |
T |
 |
| Q |
126 |
agtgggtttcgaaagtttggtcggaggtgataaggtggttggattttacttttatcacgccgccgaatttattt |
199 |
Q |
| |
|
|||||||||||||||||| ||||| || ||| |||| |||||| | ||||||| ||||| ||||||||| |
|
|
| T |
5782802 |
gttgggtttcgaaagtttggagagaggttatgcggttgttgaattttaatcttatcaccccgcctaatttattt |
5782875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University