View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_240 (Length: 243)
Name: NF10092A_low_240
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_240 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 69 - 224
Target Start/End: Complemental strand, 22837942 - 22837787
Alignment:
| Q |
69 |
gagaaagaaaagaaatcataccatgaagaagccaaaacaagctaccattaaccatgtaatcaaagacaagcaatttttcatcccttgcaaaataataagc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22837942 |
gagaaagaaaagaaatcataccatgaagaagccaaaacaagctaccattaaccatgtaatcaaagacaagcaatttttcatcccttgcaaaataataagc |
22837843 |
T |
 |
| Q |
169 |
ctttaagctaacaatgttggagtgtcttaactctccaagaacttccattctctgct |
224 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
22837842 |
ctttaagctaacaatgttggagtgttttaactttccaagaatttccattctctgct |
22837787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University