View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_242 (Length: 242)
Name: NF10092A_low_242
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_242 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 38045979 - 38045757
Alignment:
| Q |
20 |
gttaccgtcgctataacaggtacaggtggtttttcttcgacttttttagaagaaaaactaccaaatttcatatgattagcatggaacttactagaactag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38045979 |
gttaccgtcgctataacaggtacaggtggtttttcttcgacttttttagaagaaaaactaccaaatttcatatgattagcatggaacttactagaactag |
38045880 |
T |
 |
| Q |
120 |
gaggagacggagttgtatagaagctgtgtgtttcccctgcatcgatatgttgtgacatggacggcgaagactgtgacattgccttatcagttaaagcaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38045879 |
gaggagacggagttgtatagaagctgtgtgtttcccctgcatcgatttgttgtgacatggacggcgaagactgtgacattgccttatcagttaaagcaag |
38045780 |
T |
 |
| Q |
220 |
tgcttctggtgttgcattagtat |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38045779 |
tgcttctggtgttgcattagtat |
38045757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 35591680 - 35591776
Alignment:
| Q |
30 |
ctataacaggtacaggtggtttttcttcgacttttttagaagaaaaactaccaaatttcatatgattagcatggaacttactagaactaggaggaga |
126 |
Q |
| |
|
||||||||||||| |||||||||||||| || |||||||| ||| ||| | ||| |||||||||| || ||||||||| |||| || |||||||| |
|
|
| T |
35591680 |
ctataacaggtaccggtggtttttcttctacctttttagatgaactactgctaaacctcatatgattggcttggaacttaatagagctgggaggaga |
35591776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University