View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_246 (Length: 241)
Name: NF10092A_low_246
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_246 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 1715004 - 1714784
Alignment:
| Q |
19 |
taatttacatatattatatattgaataaattgattccctcaagnnnnnnnnnctagattaaattgatattgaataatttgaacctatgatgcaggaagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1715004 |
taatttacatatattatatattgaataagttgattccctcaagaaaaaaa--ctagaataaattgatattgaataatttgaacctatgatgcaggaagag |
1714907 |
T |
 |
| Q |
119 |
ttggaaaaacttgaaacaataggtgaatcttccacagtctgcaatgagtaagcaaagcaaaaacaaatactttttaaattagatttgtgctatttttcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1714906 |
ttggaaaaacttgaaacaataggtgaatcttccacagtctgcaatgagtaagcaaagcaaaaacaaatactttttaaattagatttgtgctatttttcat |
1714807 |
T |
 |
| Q |
219 |
cattgaatggtccattcattgtg |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1714806 |
cattgaatggtccattcattgtg |
1714784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University