View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_278 (Length: 232)
Name: NF10092A_low_278
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_278 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 9 - 199
Target Start/End: Original strand, 28251220 - 28251410
Alignment:
| Q |
9 |
agatggacatcagaaaagcttttgacactcttgaatggtattttatgctaaaagttcttagaagctttggtttcaatgaagctttttgcaaatggattct |
108 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28251220 |
agattgacattagaaaagcttttgatactcttgaatggtatttcctgctaaaagtttttagaagctttggtttcaatgaagctttttgaaaatggattct |
28251319 |
T |
 |
| Q |
109 |
agttattttaagattatcttttctctcagtttccattaatgggaaatctcatggttatttcaatgctactagagggttcaggcagggggat |
199 |
Q |
| |
|
||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28251320 |
agttactttaaaatcatcttttctctcagtttccattaatgggaaatctcatggttatttcaatgctactagagggttcaggaagggggat |
28251410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 229
Target Start/End: Original strand, 28252127 - 28252162
Alignment:
| Q |
194 |
ggggattctctttacctacttctattttgcttagtt |
229 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28252127 |
ggggattctctttccctacttctattttgcttagtt |
28252162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University