View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_288 (Length: 230)
Name: NF10092A_low_288
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_288 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 106 - 224
Target Start/End: Original strand, 1956962 - 1957080
Alignment:
| Q |
106 |
catattatggatttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaagcaacttcaatgaggagacatacaccaaaaag |
205 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1956962 |
catattatggatttgattaaattttcatgcactttgaaggaggctagaggctgataggtttttcacaagcaacttcaatgaggagacatacaccaaaaag |
1957061 |
T |
 |
| Q |
206 |
ggtttggaatgggtgaaca |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1957062 |
ggtttggaatgggtgaaca |
1957080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 116 - 224
Target Start/End: Original strand, 1942053 - 1942161
Alignment:
| Q |
116 |
atttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaagcaacttcaatgaggagacatacaccaaaaagggtttggaat |
215 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| |||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||| |
|
|
| T |
1942053 |
atttgattgaactttaatgcactttgcaggaggctagagggtgatagatttttcacaagcaactacaatgaggagacatacactgaaaagggtttgaaat |
1942152 |
T |
 |
| Q |
216 |
gggtgaaca |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
1942153 |
gggtgaaca |
1942161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 116 - 224
Target Start/End: Original strand, 1928076 - 1928184
Alignment:
| Q |
116 |
atttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaagcaacttcaatgaggagacatacaccaaaaagggtttggaat |
215 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| | |||||| |||||||||||| ||| ||||||||||||||||||||||||||| || |||| |
|
|
| T |
1928076 |
atttgattgaactttaatgcactttgtaggaggctagaaggtgatagatttttcacaagctactacaatgaggagacatacaccaaaaaggggttagaat |
1928175 |
T |
 |
| Q |
216 |
gggtgaaca |
224 |
Q |
| |
|
|||| |||| |
|
|
| T |
1928176 |
gggtcaaca |
1928184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 24 - 67
Target Start/End: Original strand, 36774869 - 36774912
Alignment:
| Q |
24 |
taatttttaaatcccataagaacaagtgtgatatgcctcagtat |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774869 |
taatttttaaatcccataagaacaagtgtgatatgcctcagtat |
36774912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University