View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_289 (Length: 230)
Name: NF10092A_low_289
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_289 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 33489193 - 33488970
Alignment:
| Q |
1 |
gacaatagtttcaaattaattctcactatagagaaacccctcttgtacctcccaacttgtatactaggtatctgtcatcttttgtcagacagttagaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33489193 |
gacaatagtttcaaattaattctcactatagagaaacccctcttgtacctcccaacttgtatactaggtatctgtcatcttttgtcagacagttagaaaa |
33489094 |
T |
|
| Q |
101 |
agacataggcacaagatttaacttcaacgatcttttaattaatggaacacatggtatgagacttggagcagcaagcagctggcaccatcacaaagaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33489093 |
agacataggcacaagatttaacttcaacgatcttttaattaatggaacacatggtatgagacttggagcagcaagcagctggcaccatcacaaagaatta |
33488994 |
T |
|
| Q |
201 |
ggaacactaaatcctgaacatatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33488993 |
ggaacactaaatcctgaacatatt |
33488970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University