View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_294 (Length: 230)
Name: NF10092A_low_294
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_294 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 18979906 - 18979704
Alignment:
Q |
1 |
aaaaacaaaaacatcataccattcaagttctaacaaataatttaatcaaaacaacactaaccaaataaaatatccacttacccaaatagacctgcttccc |
100 |
Q |
|
|
|||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
18979906 |
aaaaacaaaaacatcatagcatccaaattctaacaaataatttaatcaaaacaacactaaccaa-taaaatatccacttacccaaatagacctgcttccc |
18979808 |
T |
 |
Q |
101 |
acaatccctacaatcatagtcacacacatagaagtaaaaggtcagtgaaatgagaccaccaaacaataggtattggtaaatacgaaaactaagatcataa |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
T |
18979807 |
acaatccctacaatcatagtcacacacatagaagtaaaaggtcagtgaaatgagaccaccaaacaataggtattggttaatacaaaaactaagatcataa |
18979708 |
T |
 |
Q |
201 |
tctc |
204 |
Q |
|
|
|||| |
|
|
T |
18979707 |
tctc |
18979704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University