View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_304 (Length: 229)
Name: NF10092A_low_304
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_304 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33026194 - 33026416
Alignment:
| Q |
1 |
tcaagccaatcatctgttgtttggtatgacaaactttctgattcttcgtgttcaccgacttttccaaggaaggaaaaaagtaccaatcttgttgcaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026194 |
tcaagccaatcatctgttgtttggtatgacaaactttctgattcttcgtgttcaccgacttttccaaggaaggaaaaaagtaccaatcttgttgcaaagt |
33026293 |
T |
|
| Q |
101 |
tgatgggattagaacaatccccttcaagaacatttccatctgtcatgcaaaaacagtttgagaatcaaaagattgtgaatcagaagagacctgtgttcga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026294 |
tgatgggattagaacaatccccttcaagaacatttccatctgtcatgcaaaaacagtctgagaatcaaaagattgtgaatcagaagagacctgtgttcga |
33026393 |
T |
|
| Q |
201 |
gattgacacaccgaaggtaagaa |
223 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
33026394 |
gattgacacaccgaagttaagaa |
33026416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University