View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_309 (Length: 229)
Name: NF10092A_low_309
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_309 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 53097118 - 53097340
Alignment:
Q |
1 |
atactccacttctacttttcccccaatatgtgaaaattgtgattctgtggacacatttaatctgcaatatgatgacaaaacacaataaataaatatgaaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53097118 |
atactccacttctacttttcccccaatatgtgaaaattgcgattctgtggacacatttaatctgcaatatgatgacaaaacacaataaataaatatgaaa |
53097217 |
T |
 |
Q |
101 |
aagaatttgaaaatagagatttcacacaatgcaacttaaaaactacacaccccatttcaatagacaattcagagtcatgcacttcaactttgcaaccatt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53097218 |
aagaatttgaaaatagagatttcacacaatgcaacttaaaaactacacaccccatttcaatagacaattcagagtcatgcacttcaactttgcaaccatt |
53097317 |
T |
 |
Q |
201 |
ttcactcttaaccatcataggca |
223 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
53097318 |
ttcactcttaaccatcataggca |
53097340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University