View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_312 (Length: 229)
Name: NF10092A_low_312
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_312 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 51294975 - 51295198
Alignment:
| Q |
6 |
agtaagcacatcacatgaatgaaattaactttgcagtcatatagctagatcatttggtgtctaccttataacgttctacttttctagtgcgaatctgtaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294975 |
agtaagcacatcacatgaatgaaattaactttgcagtcatatagctagatcatttggtgtctaccttataacgttctacttttctagtgcgaatctgtaa |
51295074 |
T |
|
| Q |
106 |
ctttggtatacctacagaaaaagcactggattccctttcctttgtgtcaatatttcagctttagggacaacagtaaccctcattgttctcgtatttatcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51295075 |
ctttggtatacctacagaaaaagcactggattccctttcctttgtgtcaatatttcagcttttgggacaacagtaaccctcattgttctcgtatttatcc |
51295174 |
T |
|
| Q |
206 |
gattattagattatagttagttag |
229 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
51295175 |
gattattagactatagttagttag |
51295198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University