View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_321 (Length: 227)
Name: NF10092A_low_321
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_321 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 29 - 208
Target Start/End: Complemental strand, 55654648 - 55654470
Alignment:
Q |
29 |
taagatcacgtcaccaatatgatgatggtagagttggcaacatcactttacttagaaaaacaatctaggttcaattcatggagtcgcacatttggaagat |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55654648 |
taagatcacgtcaccaatatgatgatggtagagttggcaacatcactttacttagaaaaacaatctaggttcaattcatggagtcgcacatttggaagat |
55654549 |
T |
 |
Q |
129 |
atagtattagcgatcgttaactcaaaaattaatcttatagcggattcaaattggtcaatatatacaagagtgtgtttgat |
208 |
Q |
|
|
||||| || |||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
T |
55654548 |
atagt-ctaacgatcgttaacttaaaaattaatcttatagtggatttaaattggtcaatatatacgagagtgtgtttgat |
55654470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University