View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_322 (Length: 227)
Name: NF10092A_low_322
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_322 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 28244284 - 28244061
Alignment:
| Q |
1 |
tattattgtgttctttataattataaaccagatgcaagtcaactacataacttgaaatttatgtcttgatgccttacta---gaccagaaatgctcaacc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28244284 |
tattattgtgttctttataattataaactagatgcaagtcaactacataacttgaaatttatgtcttgatgccttactactagaccagaaatgctcaacc |
28244185 |
T |
 |
| Q |
98 |
aattccatttgattttcaaataatcccaaaaaattcacattcaaagaataaatgctgcaaagtttcttctcctctacaatttcccatatatgtatgttca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28244184 |
aattccatttgattttcaaataatcccaaaaaattcacattcaaagaataaatgctgcaaagtttcttctcctctacaatttcccatatatgtatgttca |
28244085 |
T |
 |
| Q |
198 |
tgcattgcatatccaagaccactt |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
28244084 |
tgcattgcatatccaagaccactt |
28244061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University