View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_323 (Length: 226)
Name: NF10092A_low_323
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_323 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 79 - 200
Target Start/End: Complemental strand, 33092559 - 33092442
Alignment:
| Q |
79 |
tctcagttgtgtgtcgaaggtctacttgatgaatgcatgtcttaagactatatatggagcaagaaattgtctcgcttgtcactaagcaaaagaagaatca |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33092559 |
tctcagttgtgtgtcgaatgtctacttgatgaatgcatgtcttaagactata----gagcaaaaaattctctcgcttgtcactaagcaaaagaagaatca |
33092464 |
T |
 |
| Q |
179 |
agtgaaatttgtgagagtccta |
200 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
33092463 |
agtgaaatttgtgagaatccta |
33092442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 79 - 193
Target Start/End: Complemental strand, 1182284 - 1182174
Alignment:
| Q |
79 |
tctcagttgtgtgtcgaaggtctacttgatgaatgcatgtcttaagactatatatggagcaagaaattgtctcgcttgtcactaagcaaaagaagaatca |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
1182284 |
tctcagttgtgtgtcgaaggtctacttgatgaatgcatgtcttaagac----tatggagcaaaaaattgtctcacttttcactaagcaaaagacgaatca |
1182189 |
T |
 |
| Q |
179 |
agtgaaatttgtgag |
193 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1182188 |
agtgaaatttgtgag |
1182174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 35 - 81
Target Start/End: Complemental strand, 33092648 - 33092602
Alignment:
| Q |
35 |
gttagattttgctttgagatccaataatatgatgatgtgaacattct |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092648 |
gttagattttgctttgagatccaataatatgatgatgtgaacattct |
33092602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University