View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_324 (Length: 225)
Name: NF10092A_low_324
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_324 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 24 - 225
Target Start/End: Complemental strand, 27492130 - 27491929
Alignment:
| Q |
24 |
ataaatatcacacattaaaatataaatcactttatattcaatt-atttttaatggtactcaatttcaaaaagttaattcactcaaaacatttattatcac |
122 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27492130 |
ataaatatcacacattaaaacataaatcacttcatattaaattcatttttaatcgtactcaatttcaaaaagttaattcactcaaaacatttattatcac |
27492031 |
T |
 |
| Q |
123 |
tagaaaatgaagcacacatcactttaagcacaaccaattttacaaaatgaattcattnnnnnnnttggtttgtgtcacatacataaccaaacacacacat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27492030 |
tagaaaatgaagcacacatcactttaagcacaaccaattttacaaaatgaattcattaaaaaaattggtttgtgtcacatacat-accaaacacacacat |
27491932 |
T |
 |
| Q |
223 |
gct |
225 |
Q |
| |
|
||| |
|
|
| T |
27491931 |
gct |
27491929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University