View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_326 (Length: 224)
Name: NF10092A_low_326
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_326 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 28086852 - 28087063
Alignment:
| Q |
13 |
atcagtaaagcaagcggagcaagctaatcctgctataaacaattcaggtttgccacctcctccagcactggcatctgcagctataaaaggccaaacaaag |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28086852 |
atcagtaaagcaaggggagcaagctaatcctgctatgagcaattcaggtttgccacctcctccagcactggcatctgcagctataaaaggccaaacaaag |
28086951 |
T |
 |
| Q |
113 |
gaacctagcaaccttactaaaatgttggattcctttgacgatcctaatagtaatgaaggattcaatcttaagattggggacaaaaatattaaaaagcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28086952 |
gaacctagcaaccttactaaaatgttggattcctttgacgaccctaatagtaatgaaggattcaatctaaagattggggacaaaaatattaaaaagcaaa |
28087051 |
T |
 |
| Q |
213 |
tgccaaagggaa |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28087052 |
tgccaaagggaa |
28087063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 224
Target Start/End: Complemental strand, 41043419 - 41043360
Alignment:
| Q |
165 |
atgaaggattcaatcttaagattggggacaaaaatattaaaaagcaaatgccaaagggaa |
224 |
Q |
| |
|
|||||||||| || || ||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
41043419 |
atgaaggatttgattttcagattggtgacaagaacattaaaaagcaaatgccaaagggaa |
41043360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University