View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_328 (Length: 224)
Name: NF10092A_low_328
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_328 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 31997902 - 31998088
Alignment:
| Q |
20 |
tccaaaaatatgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatt |
119 |
Q |
| |
|
||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31997902 |
tccaagaaaatgcctcgtggacgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatt |
31998001 |
T |
 |
| Q |
120 |
tcatggtaacagttggtttgtttatctttctggctctgcataagaattggattttaannnnnnnaatcaaagtcttttgacctattt |
206 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
31998002 |
tcttggtcacagttggtttgtttatctttctggctctgcataagaattggattttaatttttttaatcgaagtcttttgacctattt |
31998088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 114
Target Start/End: Original strand, 15843038 - 15843120
Alignment:
| Q |
32 |
cctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgct |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||| ||||||| |||| ||||| |
|
|
| T |
15843038 |
cctcgtggatgtggacttgcatagtaggagatggtcttgttggagggggcaatgtgcctctggagggaagtacattacctgct |
15843120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University