View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_33 (Length: 388)
Name: NF10092A_low_33
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 371
Target Start/End: Original strand, 21642435 - 21642805
Alignment:
| Q |
1 |
ttaaaccccggcccccatttatctcacgcccgtcatctcttcgactcacttcacgtcaaagatgttatctcatggacttcacttatctccggttacactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21642435 |
ttaaaccccggcccccatttatctcacgcccgtcatctcttcgactcacttcacgtcaaagatgtcatctcatggacttcacttatctccggttacactc |
21642534 |
T |
 |
| Q |
101 |
gctccggccagccacatcagtcgatatctttattctacgaaatgttggcatttcctattcaacccaatgcttttactctatcttccgttattaaagcttg |
200 |
Q |
| |
|
|||||| || ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
21642535 |
gctccgacctgccacatcaatcgatatctttattctacgaaatgttggcatttcctgttcaacccaatgcttttactctatcttctgttatcaaagcttg |
21642634 |
T |
 |
| Q |
201 |
ttctacgttgaatgacgtaaaccttgggagatgttttcattctatggttttaacccgtgggtttgattggaatactgttgtttcgtgttcgttgattgat |
300 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21642635 |
ttctgcgttaaatgacgtaaaccttgggagatgctttcattctatggttttaacacgtgggtttgattggaatactgttgtttcgtgttcgttgattgat |
21642734 |
T |
 |
| Q |
301 |
aggtatggttggaatcgcgcggttgatgatgcacggagggtgtttgatgaaatgtttgtgaaagatgatgt |
371 |
Q |
| |
|
| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21642735 |
atgtatggttggaatcgcgctgttgatgatgcacggagggtgtttgatgaattgtttgtgaaagatgatgt |
21642805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University