View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_330 (Length: 223)
Name: NF10092A_low_330
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_330 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 44 - 207
Target Start/End: Original strand, 52478151 - 52478313
Alignment:
| Q |
44 |
aaattaacattagagagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttattattctcagtggacattt |
143 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52478151 |
aaattaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacattt |
52478250 |
T |
 |
| Q |
144 |
acaccatcactttaccgttttttatttgtataagttaattataacggtgatcttttttaatatt |
207 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52478251 |
acaccatcactttacc-tttattatttgtataagtaaattataacggtgatcttttttaatatt |
52478313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University