View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_331 (Length: 222)
Name: NF10092A_low_331
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_331 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 216
Target Start/End: Original strand, 22443401 - 22443590
Alignment:
| Q |
24 |
gcaaaagtgtcttcggaagaacttaaaataaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtacttgc |
123 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22443401 |
gcaaaagtgtcttcggaa---cttaaaaaaaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtacttgc |
22443497 |
T |
|
| Q |
124 |
aaattatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatattcttcgaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22443498 |
aaattatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatatggttcgaca |
22443590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University