View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_335 (Length: 220)
Name: NF10092A_low_335
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_335 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 127 - 199
Target Start/End: Complemental strand, 10368546 - 10368474
Alignment:
| Q |
127 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368546 |
cacaagtttggtgacatttatataggctctttgtagatgacatattaaatcaatcaatccgttgaattgaaag |
10368474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 10368662 - 10368608
Alignment:
| Q |
11 |
actgatatgaaggagaagaagaagaatggagttcaaagattcagatttgttttct |
65 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368662 |
actgagatgaaggagaagaagaagaatggagttcaaagattcagatttgttttct |
10368608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 36116775 - 36116814
Alignment:
| Q |
17 |
atgaaggagaagaagaagaatggagttcaaagattcagat |
56 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36116775 |
atgaaggagaagaagaataatggagttcaaagattcagat |
36116814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University