View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_340 (Length: 219)
Name: NF10092A_low_340
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_340 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 2 - 219
Target Start/End: Original strand, 33499156 - 33499374
Alignment:
| Q |
2 |
gatggaggaagcttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaacttgtcttttcattccgtatgaattttat |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499156 |
gatggaggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaacttgtcttttcattccgtatgaattttat |
33499255 |
T |
 |
| Q |
102 |
tttcct-cctatcggaaacagttagaattggccatctttgatggtcctatgagacattttatggtgtttaaactagttaaattatttgctttttgtgttt |
200 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499256 |
tttccttccgatcggaaacagttagaattggccatctttgatggtcctatgagacattttatggtgtttaaactagttaaattatttgctttttgtgttt |
33499355 |
T |
 |
| Q |
201 |
gcttttccaatattgtaaa |
219 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
33499356 |
gcttttctaatattgtaaa |
33499374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 136 - 208
Target Start/End: Original strand, 33486210 - 33486284
Alignment:
| Q |
136 |
ctttgatggtcctatgagacatttt-atggtgtttaaactagtta-aattatttgctttttgtgtttgcttttcc |
208 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
33486210 |
ctttgatggtcctaagagcaatttttatggtgtttaaactagttttaattatatgctttttgtgtttgcttttcc |
33486284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 75
Target Start/End: Original strand, 33486152 - 33486212
Alignment:
| Q |
15 |
tacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttgatcataaaactt |
75 |
Q |
| |
|
|||||||| || ||| ||||||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
33486152 |
tacaagcatgcggctggagaaattatgatgtggatcgcttagaattttgatcataaaactt |
33486212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University