View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_341 (Length: 218)
Name: NF10092A_low_341
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_341 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 40289020 - 40288838
Alignment:
| Q |
18 |
cagaaacaccatcagccttgacaaacttgggtaacccatcagacaaaccacgagcaaagccaggctgagtttgtacacgaactttgactgcctccatagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40289020 |
cagaaacaccatcagccttgacaaacttgggtaacccatcagacaaaccacgagcaaagccaggctgagtttgtacacgaactttgacagcctccatagg |
40288921 |
T |
 |
| Q |
118 |
acaaagtgcacaatcagcaataacttctgctgaagcagaaccagctagatatatgaaagttttgtacttgactgcattctctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40288920 |
acaaagtgcacaatcagcaataacttctgctgaagcagaaccagctagatatatgaaagttttgtacttgactgcattctctg |
40288838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University