View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_342 (Length: 217)
Name: NF10092A_low_342
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_342 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 217
Target Start/End: Original strand, 29104100 - 29104311
Alignment:
| Q |
6 |
aatctgcaagagtaatgagatactgcattgtttcctttgtcagggaatgaactccgccgaaacttgccgctgatttggaagaatccttcaatattgtaga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104100 |
aatctgcaagagtaatgagatactgcattgtttcctctgtcagggaatgaactccgccgaaatttgccgctgatttggaagaatccttcaatattgtaga |
29104199 |
T |
|
| Q |
106 |
ctcaaattccaaaagaagatttcgtacacactcgattaatcgatgttgcgaattatatgctcgagatttaacgactgctattgaattaaacgagaaaatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29104200 |
ctcaaattccaaaagaagatttcgtacacactcgattaatcgatgttgcgaattatatgcttgagatttaacgactgctgttgaattaaacgagaaaatt |
29104299 |
T |
|
| Q |
206 |
gattcaatctcc |
217 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29104300 |
gattcaatctcc |
29104311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University