View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_346 (Length: 216)
Name: NF10092A_low_346
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_346 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 37479154 - 37478939
Alignment:
| Q |
1 |
aaatttttctgccactcttgattgaaataaggagtcactcactcagtgaacgaacgagtggttgcctatatcaatcagataaggagctttgggtataaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37479154 |
aaatttttctgccactcttgattgaaataaggagtcactcactcagtgaacgaacgagtggttgcctatatcaatcagataaggagctttgggtataaaa |
37479055 |
T |
|
| Q |
101 |
ggagtaatgcgcataactatgtgacaaaatttcaggcccctcatttcttctgttttttaatttta------atttaattaatattgctacttccactatc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37479054 |
ggagtaatgcgcataactatgtgacaaaatttcaggcccctcatttcttctgttttttaattttaattttaatttaattaatattgctacttccactatc |
37478955 |
T |
|
| Q |
195 |
actcacagtgtgtaac |
210 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37478954 |
actcacagtgtgtaac |
37478939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University