View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_348 (Length: 215)
Name: NF10092A_low_348
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_348 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 11849712 - 11849906
Alignment:
| Q |
21 |
catattggggaaaggcggtttcgctactgtatttaaaggagaattggacgatggaacaaagattgcagtgaaaaggatgaaatctgaaatggttggtgac |
120 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11849712 |
catattggggaaaggtggtttcgctactgtatacaaaggagaattggacgatggaacaaagattgcagtgaaaaggatgaaatctgaaatggttggtgac |
11849811 |
T |
 |
| Q |
121 |
gaagggttgaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggcatttggttgcactccatggctattgcttggatgacaa |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11849812 |
gaagggttaaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggcatttggttgcactccatggctattgcttggacgacaa |
11849906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 215
Target Start/End: Complemental strand, 11857417 - 11857223
Alignment:
| Q |
21 |
catattggggaaaggcggtttcgctactgtatttaaaggagaattggacgatggaacaaagattgcagtgaaaaggatgaaatctgaaatggttggtgac |
120 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11857417 |
catattggggagaggcggtttcgctactgtatacaaaggagaattggacgatggaacaacgattgcagtgaaaaggatgaaatctgaaatggttggtgat |
11857318 |
T |
 |
| Q |
121 |
gaagggttgaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggcatttggttgcactccatggctattgcttggatgacaa |
215 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11857317 |
gaagggttgaatgagatcaagtccgaaatcgcggttctcactaaggttcgacacaggcatttggttgcactccatggctattgcttggacgacaa |
11857223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 21 - 209
Target Start/End: Original strand, 11836341 - 11836529
Alignment:
| Q |
21 |
catattggggaaaggcggtttcgctactgtatttaaaggagaattggacgatggaacaaagattgcagtgaaaaggatgaaatctgaaatggttggtgac |
120 |
Q |
| |
|
||||||||| ||||||||||| || ||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11836341 |
catattgggaaaaggcggttttgccactgtatacaaaggagagttggacgatggaacaaagattgcagttaaaaggatgaaatctgaaatggttggtgac |
11836440 |
T |
 |
| Q |
121 |
gaagggttgaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggcatttggttgcactccatggctattgcttgga |
209 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11836441 |
caagggctgaatgagatcaagtccgaaatcgcggttctcactaaggttcgacacaggcatttggttgcactccttggctattgcttgga |
11836529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 209
Target Start/End: Complemental strand, 27444193 - 27444007
Alignment:
| Q |
23 |
tattggggaaaggcggtttcgctactgtatttaaaggagaattggacgatggaacaaagattgcagtgaaaaggatgaaatctgaaatggttggtgacga |
122 |
Q |
| |
|
|||| |||||||||||||||| | ||| | ||||||| |||||| |||||||||| ||||| || ||||||||| | |||| || |||||||| | |
|
|
| T |
27444193 |
tatttgggaaaggcggtttcggcattgtgtacaaaggagtattggaagatggaacaacaattgcggtaaaaaggatggtacctgagattgttggtgagaa |
27444094 |
T |
 |
| Q |
123 |
agggttgaatgagatcaagtctgaaatcgcggttctcactagggttcgacacaggcatttggttgcactccatggctattgcttgga |
209 |
Q |
| |
|
||| ||||| ||| ||||||| |||| | ||||| ||| | || |||||| |||| ||||||| || | |||| |||||||||| |
|
|
| T |
27444093 |
aggtttgaaggagttcaagtccgaaacggaagttctttctaagcttagacacaagcatctggttgcgcttcgtggccattgcttgga |
27444007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University