View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_349 (Length: 214)
Name: NF10092A_low_349
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_349 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 130 - 210
Target Start/End: Complemental strand, 18980077 - 18979997
Alignment:
| Q |
130 |
gttaatatgtgcctgaaaatgcacattttaaggaattacatatattataattccgtctaaaaattgtgtattcaaagtttt |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18980077 |
gttaatatgtgcctgaaaatggacattttaaggaattacatatattataattccgtctaaaaattgtgtattcaaagtttt |
18979997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 39
Target Start/End: Complemental strand, 18980197 - 18980164
Alignment:
| Q |
6 |
gaatagtccccaccttgcagcagcatgagcagtg |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18980197 |
gaatagtccccaccttgcagcagcatgagcagtg |
18980164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University