View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_353 (Length: 213)
Name: NF10092A_low_353
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_353 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 52 - 181
Target Start/End: Original strand, 47358642 - 47358771
Alignment:
| Q |
52 |
atttgtacaaagctttacaagtcaggcagacccaccagagatggcctaaaaggacagtgatgatgaaccacatgcatgcatgtttatgtttatctataat |
151 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358642 |
atttatacaaagctttacaagtcaggcagacccaccagagatggcctaaaaggacagtgatgatgaaccacatgcatgcatgtttatgtttatctataat |
47358741 |
T |
 |
| Q |
152 |
agcaaaactttagggtactcatcatgtaat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47358742 |
agcaaaactttagggtactcatcatgtaat |
47358771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University