View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_354 (Length: 213)
Name: NF10092A_low_354
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_354 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 32532444 - 32532261
Alignment:
| Q |
13 |
tggacatcaacatcaaataggtggagtggaaaaaacacatacaacaacaatagtttaggagtgacttgtgagacaaatttgagtcaaatggaagggttta |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32532444 |
tggaaatcaacatcaaataggtggagtggaaaaaacacatacaacaacaatagtttaggggtgagttgtgagacaaatttgagtcaaatggaagggttta |
32532345 |
T |
|
| Q |
113 |
acattaacatgtatggaaatgaagagagttgtggaatgatggtgagaaagagagttatggttgtggttgatggtacttcacatt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32532344 |
acattaacatgtatggaaatgaagagagttgtggaatgatggtgagaaagagagttatggttgtggttgatggtacttcacatt |
32532261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University