View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_362 (Length: 210)
Name: NF10092A_low_362
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092A_low_362 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 35 - 197
Target Start/End: Original strand, 2299099 - 2299261
Alignment:
Q |
35 |
atattgtcagtttttaatccatttacatgtcagaagttttgttgtaatgggtctagcaatctttaattataggagtcttctaaggttgtgaagacgtacc |
134 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
T |
2299099 |
atattgtcagttttccatccatttacatgtcagaagttttgttgtaatgggtctagcaatctttaactataggagtcttccaaggttgtgaagacgtacc |
2299198 |
T |
 |
Q |
135 |
atagaccttttggttaatgctgttactatcccttattataaaagctaaaattcatatttttcg |
197 |
Q |
|
|
|||||||||| |||||||| || ||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
2299199 |
atagacctttcggttaatgttgctactatcccttattataaaagctaaaattcatattgttcg |
2299261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University