View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_363 (Length: 210)
Name: NF10092A_low_363
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_363 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 189
Target Start/End: Original strand, 36291132 - 36291301
Alignment:
| Q |
20 |
agcttttgcaggccttcttcatcggataatatggtgccacagtttgcaatcaagaaggatgtcactgaagtaatattttttagagcacttatttttgtac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36291132 |
agcttttgcaggccttcttcatcggataatatggtgccacagtttgcaatcaagaaggatgtcactgaagtaatattttttagagcacttatttttgtac |
36291231 |
T |
 |
| Q |
120 |
acacttcattttctttatttcatgcactccttctacacattattttctttctatttatctcttcctatca |
189 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36291232 |
acacttcattttctttatttcatgcgctcgttctacacattattttctttctatttatctcttcctatca |
36291301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 36286075 - 36286153
Alignment:
| Q |
20 |
agcttttgcaggccttcttcatcggataatatggtgccacagtttgcaatcaagaaggatgtcactgaagtaatatttt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| |||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
36286075 |
agcttttgcaggccttcttcatcagataacatggagccacaatgtgcaatcaagaaagatgtcactgaagtaatatttt |
36286153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 98
Target Start/End: Original strand, 36280537 - 36280612
Alignment:
| Q |
23 |
ttttgcaggccttcttcatcggataatatggtgccacagtttgcaatcaagaaggatgtcactgaagtaatatttt |
98 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||| || ||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
36280537 |
ttttgcaggctttcttcatcagataacatggagcaacactttgcaatcaagaaggatgtcactcaagtattatttt |
36280612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University