View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10092A_low_365 (Length: 210)

Name: NF10092A_low_365
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10092A_low_365
NF10092A_low_365
[»] chr3 (1 HSPs)
chr3 (12-178)||(25696905-25697071)


Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 178
Target Start/End: Complemental strand, 25697071 - 25696905
Alignment:
12 gatggacatcaatcctagtacaaaaattgatcttgtctatcaaatatattcatatcaatgtagcagcaagactttagattgaacaccaacacacgtggtt 111  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||    
25697071 gatgcacatcaatcctagtccaaaaattgatcttgtctatcaaatatattcatatcaatgtagcaccaagaatttagattgaacaccaacacacgtggtt 25696972  T
112 acatccagttttcgaaaattattaccaatgtctacttattattgtcagtgtcgtgtccgatgtccat 178  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
25696971 acatctagttttcgaaaattattaccaatgtctacttattattgtcagtgtcgtgtctgatgtccat 25696905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University