View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_369 (Length: 207)
Name: NF10092A_low_369
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_369 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 44952313 - 44952478
Alignment:
| Q |
18 |
gttgcatggtagcttctgacatcgtgaattaagtactgcctatgtcacttaggaattcccctctcattgttctcatgtgatccaacaaatagatccacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952313 |
gttgcatggtagcttctgacatcgtgaattaagtactgcctatgtcacttaggaattcccctctcattgttctcatgtgatccaacaaatagatccacat |
44952412 |
T |
 |
| Q |
118 |
ctagtgtgtttgtgttccccgcacttaggtttgtcaagatatgatgaccacttacacacacatactt |
184 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
44952413 |
ctagtgtgtttgtgttccccacacttaggtttgtcaagatatgatgacca-ttaaacacacatactt |
44952478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University