View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_376 (Length: 202)
Name: NF10092A_low_376
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_376 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 17 - 146
Target Start/End: Original strand, 7263876 - 7264004
Alignment:
| Q |
17 |
agattgatctagtgagaggaagagaaagactcttaacgtaattattctatgaatcatgctaagagcacaaattaaaaaggtaaaatcaaatgaaatgata |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7263876 |
agattgatctagtgagaggaagaaaaagact--taacgtaattattctatgaatcgtgctaagagcacaaattaaaaaggtaaaatcgaatgaaatgata |
7263973 |
T |
|
| Q |
117 |
agatttgtgc-tgaaacgataaatttttaag |
146 |
Q |
| |
|
| ||||| | |||||||||||||||||||| |
|
|
| T |
7263974 |
aaatttgcacttgaaacgataaatttttaag |
7264004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University