View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_378 (Length: 202)
Name: NF10092A_low_378
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_378 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 182
Target Start/End: Original strand, 29002179 - 29002342
Alignment:
| Q |
19 |
caaagaagccatatctaaagaaaagtgacacttggactgcaaggattgtgaaagcagaaccatttcgtaacaatggcggttgtggttttggtagtgggga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
29002179 |
caaagaagccatatctaaagaaaagtgacacttggactgcaaggattgtgaaagccgaaccatttcgtaacaatggtggttgtggttttggtagtggtga |
29002278 |
T |
|
| Q |
119 |
tgatgatcctgttgcttgggctcaaagggagttgaaaaagtctgaaactttcaatgatagagct |
182 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002279 |
tgatgatcctgttgcttgggctgaaagggagttgaaaaagtctgaaactttcaatgatagagct |
29002342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 19 - 182
Target Start/End: Original strand, 28962456 - 28962613
Alignment:
| Q |
19 |
caaagaagccatatctaaagaaaagtgacacttggactgcaaggattgtgaaagcagaaccatttcgtaacaatggcggttgtggttttggtagtgggga |
118 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||| || |
|
|
| T |
28962456 |
caaagaagccacatctgaagaaaagtggcacttggactgcaaggattgtgaaagcagaaccatttcgtaacaatggc------ggtttttgtggtggtga |
28962549 |
T |
|
| Q |
119 |
tgatgatcctgttgcttgggctcaaagggagttgaaaaagtctgaaactttcaatgatagagct |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28962550 |
tgatgatcctgttgcttgggctcaaagggagttgaaaaagtctgaaacattcaatgatagagct |
28962613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University