View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_381 (Length: 201)
Name: NF10092A_low_381
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_381 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 21 - 181
Target Start/End: Original strand, 35489759 - 35489919
Alignment:
| Q |
21 |
tcaagagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaagactaagagaagatcag |
120 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35489759 |
tcaagagagcatatttcactgggaactaaccatcccagcgcaccccaagaccatgcaaatgccgcaacatatagacatataaagactaagagaagatcag |
35489858 |
T |
|
| Q |
121 |
cttcggtttttgtaaacgagccttcaccgctaactccaagtttgatagcaatcatacttcc |
181 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35489859 |
cttcagtttttgtaaacgagccttcaccgctaactccaagtttgatagcaatcatacttcc |
35489919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 24 - 125
Target Start/End: Complemental strand, 14233181 - 14233080
Alignment:
| Q |
24 |
agagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaagactaagagaagatcagctt |
123 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||| | |||||||||||||||||||||||||||||| ||| ||||||| |||||||| || |||| |
|
|
| T |
14233181 |
agagcgcatatttcactaggcactaaccaacccaatggtccccaagaccatgcaaatgccgcaacatatgcacaaataaagaacaagagaaggtcggctt |
14233082 |
T |
|
| Q |
124 |
cg |
125 |
Q |
| |
|
|| |
|
|
| T |
14233081 |
cg |
14233080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 24 - 125
Target Start/End: Complemental strand, 14242855 - 14242754
Alignment:
| Q |
24 |
agagagcatatttcactaggaactaaccatcccaacgcaccccaagaccatgcaaatgccgcaacatatagacatataaagactaagagaagatcagctt |
123 |
Q |
| |
|
|||| ||||| ||||||||| |||||||| ||||| | |||||||||||||||||||||||||||||| ||| ||||||| |||||||| || |||| |
|
|
| T |
14242855 |
agagcgcatacttcactaggcactaaccaacccaatggtccccaagaccatgcaaatgccgcaacatatgcacaaataaagaacaagagaaggtcggctt |
14242756 |
T |
|
| Q |
124 |
cg |
125 |
Q |
| |
|
|| |
|
|
| T |
14242755 |
cg |
14242754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University