View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_43 (Length: 377)
Name: NF10092A_low_43
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 7e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 121 - 251
Target Start/End: Original strand, 16353326 - 16353456
Alignment:
| Q |
121 |
aatatggtatgacgtatggaggacgaagcacgtgtagagggcggttatggagacctctattggatactatcagagagaagtcattcaatagaagtaatga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16353326 |
aatatggtatgacgtatggaggacgaagcacgtgtagagggcggttatggagacctctattggatactatcagagagaagtcattcaatagaagtaatga |
16353425 |
T |
|
| Q |
221 |
atccgatttgaaagaatttctttgaagtttg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16353426 |
atccgatttgaaagaatttctttgaagtttg |
16353456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University