View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_46 (Length: 375)
Name: NF10092A_low_46
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 255 - 356
Target Start/End: Complemental strand, 49293975 - 49293874
Alignment:
| Q |
255 |
ttaagtatatgtagatgtgtgaggaaaacataccgcaagcttgccggagccacggggaccgagaagaagaatagaattgttgcatgcttcagcgacggaa |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49293975 |
ttaagtatatgtagatgtgtgaggaaaacataccgcaagcttgccggagccacggggaccgagaagaagaatagaattgttgcatgcttcagcgacggaa |
49293876 |
T |
 |
| Q |
355 |
gt |
356 |
Q |
| |
|
|| |
|
|
| T |
49293875 |
gt |
49293874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 114 - 197
Target Start/End: Complemental strand, 49294116 - 49294033
Alignment:
| Q |
114 |
ggaggcaaggaattaaaaattgaattgaataccactgaaatggagtctggatattgaatcaacaaatcttgaagaactagatcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49294116 |
ggaggcaaggaattaaaaattgaattgaataccactgaaatggagtctggatattgaatcaacaaatcttgaagaactagatcc |
49294033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 49294239 - 49294196
Alignment:
| Q |
1 |
tcacaatgtaaaagcccattcaacctaacctgcaaaaatccatg |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49294239 |
tcacaatgtaaaagcccattcaacctaacctgcaaaaatccatg |
49294196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University