View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092A_low_77 (Length: 341)
Name: NF10092A_low_77
Description: NF10092A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092A_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 85 - 337
Target Start/End: Original strand, 13669429 - 13669681
Alignment:
| Q |
85 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669429 |
cagttttcaagcgacgatgaagcatcaccaagagcaatactagatgcccctgtttcaggaacagagtcagacaatagtggaagcagcagtttctcctcgt |
13669528 |
T |
|
| Q |
185 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgcaatggaaatcaatgattgatgttttcaagttcaagtc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669529 |
actcatcggagaattcaccaccggtggagggaaaattaggttggaaggaaagtaacatgatgcaatggaaatcaatgattgatgttttcaagttcaagtc |
13669628 |
T |
|
| Q |
285 |
agtgagaagattgacagctattccattgcttgctgctgttaacaatgatattg |
337 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669629 |
agtgagaagattaacagctattccattgcttgctgctgttaacaatgatattg |
13669681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University