View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092_high_2 (Length: 380)
Name: NF10092_high_2
Description: NF10092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10092_high_2 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 328 - 380
Target Start/End: Original strand, 53538451 - 53538503
Alignment:
Q |
328 |
tataaagaatgatagtgctgattttcaatagtgagctctgccatctaattcta |
380 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53538451 |
tataaagaatgatagtgctgattttcaatagtgagctctgccatctaattcta |
53538503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 271
Target Start/End: Original strand, 53540080 - 53540112
Alignment:
Q |
239 |
tgagttgtatttctctaatactagatgccgagc |
271 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
53540080 |
tgagttgtatttctctaatactagatgccgagc |
53540112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University