View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10092_low_11 (Length: 234)
Name: NF10092_low_11
Description: NF10092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10092_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 67 - 222
Target Start/End: Original strand, 23075322 - 23075477
Alignment:
| Q |
67 |
tttccaacttgtggctattgtcacttataagcttgtttctgcctccatacatactttcctagctcacatgcctgaatcacatgctcaatcctattttgca |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23075322 |
tttccaacttgtggctattgtcacttataagcttgtttctgcctccatacatactttcctagctcacatgcctgaatcacatgctcaatcctattttgca |
23075421 |
T |
 |
| Q |
167 |
agattctacattgctctacatcctgacctgctgccagatagaactcacaccacctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23075422 |
agattctacattgctctacatcctgacctgctgccagatagaattcacaccacctt |
23075477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 23075230 - 23075283
Alignment:
| Q |
19 |
ttgatcctctaaaatatcttcttctacataaatgcttcttgtttcttctttcca |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23075230 |
ttgatcctctaaaatatcttcttctacataaatgcttcttgtttcttctttcca |
23075283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University