View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10093_high_8 (Length: 244)
Name: NF10093_high_8
Description: NF10093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10093_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 3 - 233
Target Start/End: Complemental strand, 53219683 - 53219453
Alignment:
| Q |
3 |
ttcaaattcctccttacatgattatgcgaattctagattgagggaacatgtccagggagctgacaacaatcctcttctcatatgtcctgagggaacttgt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53219683 |
ttcaaattcctccttacatgattatgcgtattctagattgagggaacatgtccagggagctgacaacaatcctcttctcatatttcctgagggaacttgt |
53219584 |
T |
 |
| Q |
103 |
gtaaataatcactatacagtcatgttcaagaaggtttgtgaatcatttgcaactacagtcatgtaaaatgttatcatattcgtgcagtagtttttctttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
53219583 |
gtaaataatcactatacagtcatgttcaagaaggtttgtgaatcatttgcaactacagtcatgtaaaatgttatcatatttgtgcagtagcttttctttt |
53219484 |
T |
 |
| Q |
203 |
gttgttctgttattttgcactcattgatgtc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
53219483 |
gttgttctgttattttgcactcattgatgtc |
53219453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 230
Target Start/End: Complemental strand, 15411574 - 15411350
Alignment:
| Q |
15 |
cttacatgattatgcgaattctagattgagggaacatgtccagggagctgacaacaatcctcttctcatatgtcctgagggaacttgtgtaaataatcac |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15411574 |
cttacatgattatgcatattctagattgagggaacatgtccagggagctgacaataatcctcttctcatatttcctgagggaacttgtgtaaataatcac |
15411475 |
T |
 |
| Q |
115 |
tatacagtcatgttcaagaaggtttgtgaatcatttgcaactacagtcatgtaaa---------atgttatcatattcgtgcagtagtttttcttttgtt |
205 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||| |||||||||||||| ||||||||||||| ||||| ||| ||||||||| || |
|
|
| T |
15411474 |
tatacagtcatgttcaagaaggtatttgaatcatttgcaattacagtcatgtaaaatgcagtttatgttatcatattagtgcaatagcttttcttttttt |
15411375 |
T |
 |
| Q |
206 |
gttctgttattttgcactcattgat |
230 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
15411374 |
gttctgttattttgcacccattgat |
15411350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University