View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10093_low_6 (Length: 255)
Name: NF10093_low_6
Description: NF10093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10093_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 51579185 - 51578968
Alignment:
| Q |
19 |
gcgtgaccagtaccgtgcctactgtacgtaattttttagatggacaaaacttagctgcattttcttaggtgttttttcatttgcttcttgactaaaaata |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51579185 |
gcgtgaccagtaccgggcctactgtacgtaattttttagatggacaaaacttagctgcattttcttaggtgttttttcatttgcttcttgactaaaaata |
51579086 |
T |
|
| Q |
119 |
c----nnnnnnnnnnngctataacaaacttcnnnnnnnttatggatttgagaaaattatgtatagtttagttaagaaccatatgaatgtccttagatcct |
214 |
Q |
| |
|
| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51579085 |
cattttttttttttttgctttaacaaacttcaaaaaaattatggatttgagaaaattatgtatagtttagttaagaaccatatgaatgtccttagatcct |
51578986 |
T |
|
| Q |
215 |
taaaggatttatgttctg |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51578985 |
taaaggatttatgttctg |
51578968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 94
Target Start/End: Complemental strand, 54126696 - 54126660
Alignment:
| Q |
58 |
atggacaaaacttagctgcattttcttaggtgttttt |
94 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
54126696 |
atggacaaaacttaggtgcatttccttaggtgttttt |
54126660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University