View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10094_high_3 (Length: 250)
Name: NF10094_high_3
Description: NF10094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10094_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 40238085 - 40238324
Alignment:
Q |
1 |
caaagatgtagaatttgttagtaattcatccccttctagctttgatcttttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40238085 |
caaagatgtagaatttgttagtaattcatccccttctagctttgatcttttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttg |
40238184 |
T |
 |
Q |
101 |
ttgcacgttttgcactcatattccactggtgcaaaacttttttgatttggtttattgttttgtggttgatgttggggataagagagcatcattagacaat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40238185 |
ttgcacgttttgcactcatattccactggtgcaaaacttttttgatttggtttattgttttgtggttgatgttggggataagagagcatcattagacaat |
40238284 |
T |
 |
Q |
201 |
ttgctaaatctatgttttctaacccttcgaaatctctctg |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40238285 |
ttgctaaatctatgttttctaacccttcgaaatctctctg |
40238324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 50 - 123
Target Start/End: Original strand, 40243780 - 40243853
Alignment:
Q |
50 |
ttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttgttgcacgttttgcactcatattc |
123 |
Q |
|
|
||||||||||| || |||||||| || |||||||| |||| |||||||||||||||||||||||| |||||||| |
|
|
T |
40243780 |
ttgtggctagccctatggccaccaagggcttgaaaagatgagaattttttgttgcacgttttgcattcatattc |
40243853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University