View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10094_low_3 (Length: 299)
Name: NF10094_low_3
Description: NF10094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10094_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 153 - 294
Target Start/End: Complemental strand, 48756119 - 48755978
Alignment:
| Q |
153 |
tttcagttcagtttgaaaattaagaaccagttcaccgaactataacaccagtcctattcaattcggaccaaactattaacaaatcggttcggttcagttg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
48756119 |
tttcagttcagtttgaaaattaagaaccagttcaccgaactataacaccagtccgattcaattcggaccaaactattaacaaattggtttggttcagttg |
48756020 |
T |
 |
| Q |
253 |
tctgtatgaaccaaaccatgaacggtccgagttcttctcact |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48756019 |
tctgtatgaaccaaaccatgaacggtccgagttcttatcact |
48755978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 97
Target Start/End: Complemental strand, 48756246 - 48756161
Alignment:
| Q |
16 |
aatttaataggaacaaatagagaatttaaagcaaatcatgtagag-tttca---tgtcgattcagtccaagcatattgttgatttg |
97 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48756246 |
aatttaatagaaacaaatagagaatttaaagcaaatcatgtagagttttcatgttgtcgattcagtccaagcatattgttgatttg |
48756161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University