View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10095_high_2 (Length: 302)
Name: NF10095_high_2
Description: NF10095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10095_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 45520841 - 45520555
Alignment:
Q |
1 |
catacaggtggcctcttaggattggatgaaaaggtcgatcagatgggttcctttgaagggaattggcaacgaatggatgttaatgaatctgttcccaggc |
100 |
Q |
|
|
|||||||||||||||||||||||| |||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45520841 |
catacaggtggcctcttaggattgtatgacaaggtcgatcagctgggttcctttgtagggaattggcaacgaatggatgttaatgaatctgttcccaggc |
45520742 |
T |
 |
Q |
101 |
aagatggaattggaaagatgttctagagaaagaaagtaaaacccttattgtttgcatttatgtctgtataaatatatcttgctccaaataagttatactt |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45520741 |
aagatggaattggaaagatgttctagagaaagaaagtaaaacccttattgtttgcatgtatgtctgtataaatatatcttgctccaaataagttatactt |
45520642 |
T |
 |
Q |
201 |
ttattgcagtgcttacacactgaatcctgatgttgacataatgataataaaaatgcccaaaaagaaaacgacgtctagggtggagat |
287 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45520641 |
ttattgcagtgcttacacactgaatcctgatgttgacataatgataataaaaatgcccaaaaagaaaacgacgtctagggtggagat |
45520555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University