View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10095_high_6 (Length: 235)
Name: NF10095_high_6
Description: NF10095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10095_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 102 - 216
Target Start/End: Complemental strand, 9169742 - 9169632
Alignment:
| Q |
102 |
ttgtgagtgacatgttgaatgaatcactcttcaaacttgtataatttcnnnnnnnnnnnnctttgtaagccctcttagaggaggcagaagataatagaca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9169742 |
ttgtgagtgacatgttgaatgaatcactcttcaaacttgtataatttcatatatat----cttagtaagccctcttagaggaggcagaagataatagaca |
9169647 |
T |
|
| Q |
202 |
tatactagtagtcta |
216 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9169646 |
tatactagtagtcta |
9169632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 90
Target Start/End: Original strand, 9258594 - 9258649
Alignment:
| Q |
35 |
tacaattgagattcaagggacatccaatggatgcatcactcagaccaattccaagg |
90 |
Q |
| |
|
|||| ||||| || ||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
9258594 |
tacagttgagcttgaagggacatccaatggaagcatcacttagaccatttccaagg |
9258649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University