View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10095_low_1 (Length: 370)
Name: NF10095_low_1
Description: NF10095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10095_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 15 - 262
Target Start/End: Original strand, 4319280 - 4319526
Alignment:
| Q |
15 |
tggacatcacttattacacatgcgttaaattgattttgaccaatctcgaccattgattttaaaatcagatggtcggtcatagttactgtgtcatgccgtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
4319280 |
tggacatcacttattacacatgcgttaaattgattttgaccaatctcgaccatcgattt-aaaatcagatggtcagtcatagttactgtgtcatgtcgtt |
4319378 |
T |
 |
| Q |
115 |
attgctgccaattccatatatggaaaatccttgttggtacaaagaccaacaagcacgactgcacccgaatagtttcattccgtaagatgagccatttttc |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4319379 |
attgccgccaattccatatatggaaaatccttgttggtacgaagaccaacaagcacgactgcaccctaatagtttcattccgtaagatgagccatttttc |
4319478 |
T |
 |
| Q |
215 |
cttttattaaatattttcaatcttccacttttttcatcgtctaaattc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4319479 |
cttttattaaatattttcaatcttccacttttttcatcgtctaaattc |
4319526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 280 - 353
Target Start/End: Original strand, 4319626 - 4319699
Alignment:
| Q |
280 |
gagagaattaagactaatatttaccttagctggattggcaacaaaaatacgagagataagttccctacaatctg |
353 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4319626 |
gagagagttaagactaatatttacctaagctggattggcaacaaaaatacgagagataagttccctacaatctg |
4319699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University