View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10095_low_5 (Length: 268)
Name: NF10095_low_5
Description: NF10095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10095_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 16 - 169
Target Start/End: Original strand, 46245176 - 46245329
Alignment:
| Q |
16 |
tcagcttcatcatactgaactagtcatctccattgaagcatcatgcagttatgttcccatattgaacaaaacgtaggcttcaccatttgttcccacccca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46245176 |
tcagcttcatcatactgaactagtcatctccattgaagcatcatgcagttatgttcccatattgaacaaaacgtaggcttcaccatttgttcccacccca |
46245275 |
T |
 |
| Q |
116 |
gttgccgccacgacctctaccaccaccgttggaaaatctatcacttgaaaatct |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46245276 |
gttgccgccacgacctctaccaccaccgttggaaaatctatcacttgaaaatct |
46245329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 16 - 169
Target Start/End: Original strand, 46254864 - 46255017
Alignment:
| Q |
16 |
tcagcttcatcatactgaactagtcatctccattgaagcatcatgcagttatgttcccatattgaacaaaacgtaggcttcaccatttgttcccacccca |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
46254864 |
tcagcttcatcgtactgaactagtcatctccattgaagcatcatgcagctatgttcccatattgaacaaatagtaggcttcaccaaatgttcccaaccca |
46254963 |
T |
 |
| Q |
116 |
gttgccgccacgacctctaccaccaccgttggaaaatctatcacttgaaaatct |
169 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
46254964 |
gttgcccccacgacctctaccaccatcgttggaaaacctatcacttgaaaatct |
46255017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 16 - 119
Target Start/End: Complemental strand, 46162081 - 46161974
Alignment:
| Q |
16 |
tcagcttcatcatactgaactagtcatctccattgaagcatcatgcagttatgttccc----atattgaacaaaacgtaggcttcaccatttgttcccac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
46162081 |
tcagcttcatcatactgaactagtcatctccattaaagcaacatgcagttatgttcccatatatattgaacaaaaagtaggcttcgccatttgttcccac |
46161982 |
T |
 |
| Q |
112 |
cccagttg |
119 |
Q |
| |
|
|||||||| |
|
|
| T |
46161981 |
cccagttg |
46161974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University